Review



pbmn mcherry parkin  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Addgene inc pbmn mcherry parkin
    Pbmn Mcherry Parkin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbmn+mcherry+parkin/pBMN-mCherry-Parkin+(Plasmid+%2359419)/pmc12759083-20-0-2
    Average 93 stars, based on 13 article reviews
    pbmn mcherry parkin - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    other:

    Article Title: A degradative to secretory autophagy switch mediates mitochondria clearance in the absence of the mATG8-conjugation machinery
    Article Snippet: pLV-mitoGFP was a kind gift from Pantelis Tsoulfas (Addgene #44385). pMDLg/pRRE (Addgene #12251), pRSV-Rev (Addgene #12253), pMD2.G-VSVg (Addgene #12259) were kind gifts from Didier Trono. pBMN-mCherry-Parkin (Addgene #59419) was a kind gift from Richard Youle. pUMVC-gagpol (Addgene #8449) was a kind gift from Bob Weinberg. pSpCas9(BB)-2A-Puro PX459 (#62988) was a kind gift from Feng Zhang. pFU-Cas9-T2a-miRFP670 was a kind gift from Naiyang Fu (Duke-NUS, Singapore).

    Polymerase Chain Reaction:

    Article Title: In situ cryo-ET visualization of mitochondrial depolarization and mitophagic engulfment
    Article Snippet: To generate mCherry-Parkin and BFP-mito lentiviruses for cell line generation 4E6 HEK293T cells were seeded into 10 cm plates and transfected the next day with 45 μL Mirus LT1 transfection reagent (MIR2300) added to a mixture of 5 μg each (15 μg total) of plasmids VSV-G (addgene: 8454), R8.74 (addgene: 22036) or CMV-Gagpol (addgene: 35614), and one of the following: pLV-mCherry-Parkin (this study), pLV-BFP-mito (this study), and Su9-GFP-HALO (addgene: 184905) in 1.5 mL Optimem (ThermoFischer catalog: 31985062) according to manufacturer recommendations. .. Both lentivirus plasmids were restriction subcloned using NheI and BsrGI into pMK1253 (addgene: 133058) from pBMN-mCherry-Parkin (addgene: 59419, PCR amplified to include a c-terminal BsrGI cut-site) and EBFP2-mito-7 (addgene: 55248). ..

    Amplification:

    Article Title: In situ cryo-ET visualization of mitochondrial depolarization and mitophagic engulfment
    Article Snippet: To generate mCherry-Parkin and BFP-mito lentiviruses for cell line generation 4E6 HEK293T cells were seeded into 10 cm plates and transfected the next day with 45 μL Mirus LT1 transfection reagent (MIR2300) added to a mixture of 5 μg each (15 μg total) of plasmids VSV-G (addgene: 8454), R8.74 (addgene: 22036) or CMV-Gagpol (addgene: 35614), and one of the following: pLV-mCherry-Parkin (this study), pLV-BFP-mito (this study), and Su9-GFP-HALO (addgene: 184905) in 1.5 mL Optimem (ThermoFischer catalog: 31985062) according to manufacturer recommendations. .. Both lentivirus plasmids were restriction subcloned using NheI and BsrGI into pMK1253 (addgene: 133058) from pBMN-mCherry-Parkin (addgene: 59419, PCR amplified to include a c-terminal BsrGI cut-site) and EBFP2-mito-7 (addgene: 55248). ..

    Infection:

    Article Title: Phase II trial of cytarabine and mitoxantrone with devimistat in acute myeloid leukemia
    Article Snippet: Antibodies against TOM20 (Cell Signaling, #42406; 1:1000), VDAC (Abcam, ab14734; 1:1000), and β-actin (Abcam, ab8227; 1:2000) were used. .. MFL2 cells were infected with pBMN-mCherry-Parkin, which was a gift from Richard Youle (Addgene plasmid #59419) and seeded on polylysine (Sigma Aldrich) covered four-well chamber slides. .. Then the cells were treated with 100 μM devimistat or 10 μM FCCP for 24 h. Cells were incubated with MitoTracker Deep Red (ThermoFisher, Waltham, MA) for 30 min at 37 °C.

    Plasmid Preparation:

    Article Title: Phase II trial of cytarabine and mitoxantrone with devimistat in acute myeloid leukemia
    Article Snippet: Antibodies against TOM20 (Cell Signaling, #42406; 1:1000), VDAC (Abcam, ab14734; 1:1000), and β-actin (Abcam, ab8227; 1:2000) were used. .. MFL2 cells were infected with pBMN-mCherry-Parkin, which was a gift from Richard Youle (Addgene plasmid #59419) and seeded on polylysine (Sigma Aldrich) covered four-well chamber slides. .. Then the cells were treated with 100 μM devimistat or 10 μM FCCP for 24 h. Cells were incubated with MitoTracker Deep Red (ThermoFisher, Waltham, MA) for 30 min at 37 °C.

    Article Title: Parkin is an E3 ligase for the ubiquitin-like modifier FAT10, which inhibits Parkin activation and mitophagy.
    Article Snippet: .. pRK5-Myc-Parkin (Myc-Parkin) plasmid was a gift from Ted Dawson (Addgene plasmid # 17612); pM2.G and psPAX2 vectors were a kind gift from Didier Trono (Addgene plasmid #12259 and #12260); pET28a/6His-GST-3C-Parkin (GST-Parkin) was a gift from David Komander (Addgene plasmid #110758); pCMV6/Myc-Mul1 (Myc-Mul1) was purchased from Origene. pEGFP-N2/MARCH5 (GFPMARCH5) plasmid was a kind gift of Eric Schirmer (Addgene plasmid #62039). pEGFP-parkin WT (EGFP-Parkin) plasmid was a gift from Edward Fon (Addgene plasmid # 45875); pcDNA3.1/Myc-His-Mfn2 (Myc-Mfn2) plasmid was a gift from David Chan (Addgene plasmid # 23213). pBMN-mCherry-Parkin (mCherry Parkin) and pCHAC-mt-mKeima (mtKeima) was a gift from Richard Youle (Addgene plasmid # 72342). pRK5-Myc-Parkin C431A (Myc-Parkin C431A) plasmid was generated by site-directed mutagenesis of pRK5-Myc-Parkin plasmid with primers fwd 50-cggacacttcatgtgcatgacgcctccatttttttccact-30, rev 50 agtggaaaaaaatggaggcgtcatg cacatgaagtgtccg-3. pET28a/6His-GST-3C-Parkin C431A (GST-Parkin C431A) plasmid was generated by site-directed mutagenesis of pET28a/6His-GST-3C-Parkin plasmid with primers fwd 50-gtcgagaaaaacggcggtgccatgcacatgaaatgtcc-30, rev 50-ggacatttcatgtg catggcaccgccgtttttctccac-30.To generate pcDNA4/TO-3xFLAG-FAT10, 3xFLAG-FAT10 was cloned from pcDNA-His-3xFLAGFAT10 with HindIII and NotI into pcDNA4/TO plasmid (Thermo Fisher). ..

    Generated:

    Article Title: Parkin is an E3 ligase for the ubiquitin-like modifier FAT10, which inhibits Parkin activation and mitophagy.
    Article Snippet: .. pRK5-Myc-Parkin (Myc-Parkin) plasmid was a gift from Ted Dawson (Addgene plasmid # 17612); pM2.G and psPAX2 vectors were a kind gift from Didier Trono (Addgene plasmid #12259 and #12260); pET28a/6His-GST-3C-Parkin (GST-Parkin) was a gift from David Komander (Addgene plasmid #110758); pCMV6/Myc-Mul1 (Myc-Mul1) was purchased from Origene. pEGFP-N2/MARCH5 (GFPMARCH5) plasmid was a kind gift of Eric Schirmer (Addgene plasmid #62039). pEGFP-parkin WT (EGFP-Parkin) plasmid was a gift from Edward Fon (Addgene plasmid # 45875); pcDNA3.1/Myc-His-Mfn2 (Myc-Mfn2) plasmid was a gift from David Chan (Addgene plasmid # 23213). pBMN-mCherry-Parkin (mCherry Parkin) and pCHAC-mt-mKeima (mtKeima) was a gift from Richard Youle (Addgene plasmid # 72342). pRK5-Myc-Parkin C431A (Myc-Parkin C431A) plasmid was generated by site-directed mutagenesis of pRK5-Myc-Parkin plasmid with primers fwd 50-cggacacttcatgtgcatgacgcctccatttttttccact-30, rev 50 agtggaaaaaaatggaggcgtcatg cacatgaagtgtccg-3. pET28a/6His-GST-3C-Parkin C431A (GST-Parkin C431A) plasmid was generated by site-directed mutagenesis of pET28a/6His-GST-3C-Parkin plasmid with primers fwd 50-gtcgagaaaaacggcggtgccatgcacatgaaatgtcc-30, rev 50-ggacatttcatgtg catggcaccgccgtttttctccac-30.To generate pcDNA4/TO-3xFLAG-FAT10, 3xFLAG-FAT10 was cloned from pcDNA-His-3xFLAGFAT10 with HindIII and NotI into pcDNA4/TO plasmid (Thermo Fisher). ..

    Mutagenesis:

    Article Title: Parkin is an E3 ligase for the ubiquitin-like modifier FAT10, which inhibits Parkin activation and mitophagy.
    Article Snippet: .. pRK5-Myc-Parkin (Myc-Parkin) plasmid was a gift from Ted Dawson (Addgene plasmid # 17612); pM2.G and psPAX2 vectors were a kind gift from Didier Trono (Addgene plasmid #12259 and #12260); pET28a/6His-GST-3C-Parkin (GST-Parkin) was a gift from David Komander (Addgene plasmid #110758); pCMV6/Myc-Mul1 (Myc-Mul1) was purchased from Origene. pEGFP-N2/MARCH5 (GFPMARCH5) plasmid was a kind gift of Eric Schirmer (Addgene plasmid #62039). pEGFP-parkin WT (EGFP-Parkin) plasmid was a gift from Edward Fon (Addgene plasmid # 45875); pcDNA3.1/Myc-His-Mfn2 (Myc-Mfn2) plasmid was a gift from David Chan (Addgene plasmid # 23213). pBMN-mCherry-Parkin (mCherry Parkin) and pCHAC-mt-mKeima (mtKeima) was a gift from Richard Youle (Addgene plasmid # 72342). pRK5-Myc-Parkin C431A (Myc-Parkin C431A) plasmid was generated by site-directed mutagenesis of pRK5-Myc-Parkin plasmid with primers fwd 50-cggacacttcatgtgcatgacgcctccatttttttccact-30, rev 50 agtggaaaaaaatggaggcgtcatg cacatgaagtgtccg-3. pET28a/6His-GST-3C-Parkin C431A (GST-Parkin C431A) plasmid was generated by site-directed mutagenesis of pET28a/6His-GST-3C-Parkin plasmid with primers fwd 50-gtcgagaaaaacggcggtgccatgcacatgaaatgtcc-30, rev 50-ggacatttcatgtg catggcaccgccgtttttctccac-30.To generate pcDNA4/TO-3xFLAG-FAT10, 3xFLAG-FAT10 was cloned from pcDNA-His-3xFLAGFAT10 with HindIII and NotI into pcDNA4/TO plasmid (Thermo Fisher). ..

    Clone Assay:

    Article Title: Parkin is an E3 ligase for the ubiquitin-like modifier FAT10, which inhibits Parkin activation and mitophagy.
    Article Snippet: .. pRK5-Myc-Parkin (Myc-Parkin) plasmid was a gift from Ted Dawson (Addgene plasmid # 17612); pM2.G and psPAX2 vectors were a kind gift from Didier Trono (Addgene plasmid #12259 and #12260); pET28a/6His-GST-3C-Parkin (GST-Parkin) was a gift from David Komander (Addgene plasmid #110758); pCMV6/Myc-Mul1 (Myc-Mul1) was purchased from Origene. pEGFP-N2/MARCH5 (GFPMARCH5) plasmid was a kind gift of Eric Schirmer (Addgene plasmid #62039). pEGFP-parkin WT (EGFP-Parkin) plasmid was a gift from Edward Fon (Addgene plasmid # 45875); pcDNA3.1/Myc-His-Mfn2 (Myc-Mfn2) plasmid was a gift from David Chan (Addgene plasmid # 23213). pBMN-mCherry-Parkin (mCherry Parkin) and pCHAC-mt-mKeima (mtKeima) was a gift from Richard Youle (Addgene plasmid # 72342). pRK5-Myc-Parkin C431A (Myc-Parkin C431A) plasmid was generated by site-directed mutagenesis of pRK5-Myc-Parkin plasmid with primers fwd 50-cggacacttcatgtgcatgacgcctccatttttttccact-30, rev 50 agtggaaaaaaatggaggcgtcatg cacatgaagtgtccg-3. pET28a/6His-GST-3C-Parkin C431A (GST-Parkin C431A) plasmid was generated by site-directed mutagenesis of pET28a/6His-GST-3C-Parkin plasmid with primers fwd 50-gtcgagaaaaacggcggtgccatgcacatgaaatgtcc-30, rev 50-ggacatttcatgtg catggcaccgccgtttttctccac-30.To generate pcDNA4/TO-3xFLAG-FAT10, 3xFLAG-FAT10 was cloned from pcDNA-His-3xFLAGFAT10 with HindIII and NotI into pcDNA4/TO plasmid (Thermo Fisher). ..



    Similar Products

    93
    Addgene inc pbmn mcherry parkin
    Pbmn Mcherry Parkin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbmn+mcherry+parkin/pBMN-mCherry-Parkin+(Plasmid+%2359419)/pmc12759083-20-0-2
    Average 93 stars, based on 1 article reviews
    pbmn mcherry parkin - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc plasmid encoding mcherryparkin
    Plasmid Encoding Mcherryparkin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbmn+mcherry+parkin/pBMN-mCherry-Parkin+(Plasmid+%2359419)/pm39872984-276-20-23
    Average 93 stars, based on 1 article reviews
    plasmid encoding mcherryparkin - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc plasmid encoding mcherry parkin
    Plasmid Encoding Mcherry Parkin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbmn+mcherry+parkin/pBMN-mCherry-Parkin+(Plasmid+%2359419)/pmc11749863-224-19-22
    Average 93 stars, based on 1 article reviews
    plasmid encoding mcherry parkin - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc pbmnmcherry parkin
    Pbmnmcherry Parkin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbmn+mcherry+parkin/pBMN-mCherry-Parkin+(Plasmid+%2359419)/pm39288201-348-35-42
    Average 93 stars, based on 1 article reviews
    pbmnmcherry parkin - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc ampr addgene plasmid no 59419
    Ampr Addgene Plasmid No 59419, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbmn+mcherry+parkin/pBMN-mCherry-Parkin+(Plasmid+%2359419)/pm39288201-337-0-1
    Average 93 stars, based on 1 article reviews
    ampr addgene plasmid no 59419 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    90
    Addgene inc pbmn-mcherry-parkin
    Pbmn Mcherry Parkin, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pbmn+mcherry+parkin/pbmn+mcherry+parkin/pmc09240011-237-23-26
    Average 90 stars, based on 1 article reviews
    pbmn-mcherry-parkin - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results